ID: 923546751_923546761

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 923546751 923546761
Species Human (GRCh38) Human (GRCh38)
Location 1:234928918-234928940 1:234928962-234928984
Sequence CCCAGGGCCTAAGGTTTACAGAG GGGTCCTTCACTCTTTGGTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!