ID: 923779813_923779821

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 923779813 923779821
Species Human (GRCh38) Human (GRCh38)
Location 1:237012104-237012126 1:237012133-237012155
Sequence CCTCTGGTTCGGAGACTCTGGTG GGATGCTGCACTTTGCCGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!