ID: 923803866_923803870

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 923803866 923803870
Species Human (GRCh38) Human (GRCh38)
Location 1:237237415-237237437 1:237237443-237237465
Sequence CCCAAAGAAACCTGAAAAACTAG GCTATGAAAAGAAGTGGAATTGG
Strand - +
Off-target summary {0: 22, 1: 42, 2: 124, 3: 404, 4: 1316} {0: 1, 1: 0, 2: 0, 3: 26, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!