ID: 924226478_924226490

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 924226478 924226490
Species Human (GRCh38) Human (GRCh38)
Location 1:241926388-241926410 1:241926440-241926462
Sequence CCCTTCCTTTTTCCCTCCACATC ACACAGCAACTTTTGGCTTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 110, 4: 1110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!