ID: 924516329_924516338

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 924516329 924516338
Species Human (GRCh38) Human (GRCh38)
Location 1:244769037-244769059 1:244769072-244769094
Sequence CCAAGCACACAGGTTCTCTTTTT CACTGTTAGGAGATTGGGGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!