ID: 924979676_924979685

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 924979676 924979685
Species Human (GRCh38) Human (GRCh38)
Location 2:208103-208125 2:208130-208152
Sequence CCCAAACTCCTAAGTTGAAATCT CCCAGTTTGACGGGGTTAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 29, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!