ID: 924985240_924985241

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 924985240 924985241
Species Human (GRCh38) Human (GRCh38)
Location 2:264394-264416 2:264408-264430
Sequence CCACGTGCGCGAGACTCGCGCTG CTCGCGCTGTGCCCCAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 15} {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!