ID: 924985245_924985251

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 924985245 924985251
Species Human (GRCh38) Human (GRCh38)
Location 2:264419-264441 2:264432-264454
Sequence CCCCAACCCAGGTGGGCGGCCCG GGGCGGCCCGCGGAGCCGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112} {0: 1, 1: 0, 2: 5, 3: 40, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!