ID: 925403789_925403798

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 925403789 925403798
Species Human (GRCh38) Human (GRCh38)
Location 2:3592184-3592206 2:3592220-3592242
Sequence CCGAGATGGCAGCAGCACCGTCC CATCAGAGGGAGACCGTGGAAGG
Strand - +
Off-target summary No data {0: 87, 1: 19, 2: 6, 3: 18, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!