ID: 925931977_925931981

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925931977 925931981
Species Human (GRCh38) Human (GRCh38)
Location 2:8715333-8715355 2:8715349-8715371
Sequence CCCCAAGGTAAGATGACACTATG CACTATGAAGACTTCTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!