ID: 926171640_926171648

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 926171640 926171648
Species Human (GRCh38) Human (GRCh38)
Location 2:10556440-10556462 2:10556474-10556496
Sequence CCGCGAGTCCCCCCATGGTGCCT CTGCCCATCCCAGGCCTCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 52, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!