ID: 926825564_926825569

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 926825564 926825569
Species Human (GRCh38) Human (GRCh38)
Location 2:16902213-16902235 2:16902261-16902283
Sequence CCACCAAAGCTCAGTAACAAGCC GGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 161, 3: 189, 4: 295} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!