ID: 926825565_926825569

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 926825565 926825569
Species Human (GRCh38) Human (GRCh38)
Location 2:16902216-16902238 2:16902261-16902283
Sequence CCAAAGCTCAGTAACAAGCCAAG GGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 200, 3: 330, 4: 732} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!