ID: 927472352_927472363

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 927472352 927472363
Species Human (GRCh38) Human (GRCh38)
Location 2:23385698-23385720 2:23385732-23385754
Sequence CCGCTCTCCATCAGCCCTCCTGC ACCCCGGGCTCTCTGCGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 84, 4: 561} {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!