ID: 927472353_927472365

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 927472353 927472365
Species Human (GRCh38) Human (GRCh38)
Location 2:23385705-23385727 2:23385733-23385755
Sequence CCATCAGCCCTCCTGCGCCCACC CCCCGGGCTCTCTGCGCGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 504} {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!