ID: 927472361_927472379

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 927472361 927472379
Species Human (GRCh38) Human (GRCh38)
Location 2:23385726-23385748 2:23385774-23385796
Sequence CCCGCGACCCCGGGCTCTCTGCG GCCGGAGGTAAGAGCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 191} {0: 1, 1: 0, 2: 4, 3: 25, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!