ID: 927472364_927472381

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 927472364 927472381
Species Human (GRCh38) Human (GRCh38)
Location 2:23385733-23385755 2:23385775-23385797
Sequence CCCCGGGCTCTCTGCGCGTCGGG CCGGAGGTAAGAGCCGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85} {0: 1, 1: 0, 2: 3, 3: 32, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!