ID: 927472372_927472377

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 927472372 927472377
Species Human (GRCh38) Human (GRCh38)
Location 2:23385756-23385778 2:23385769-23385791
Sequence CCGGGGCCGGAGCCGCGCGCCGG CGCGCGCCGGAGGTAAGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 403} {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!