ID: 927519450_927519454

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 927519450 927519454
Species Human (GRCh38) Human (GRCh38)
Location 2:23690144-23690166 2:23690166-23690188
Sequence CCCTGGGAGGGCGGTGCCTGACC CTCAGAGAATGTCGCTCTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146} {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!