ID: 927783916_927783920

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 927783916 927783920
Species Human (GRCh38) Human (GRCh38)
Location 2:25959315-25959337 2:25959341-25959363
Sequence CCCTGTGAGCTCCCTCATGGCAG TCATATCTTACTCATATCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 199} {0: 1, 1: 1, 2: 1, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!