|
Left Crispr |
Right Crispr |
| Crispr ID |
929070023 |
929070029 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:38020543-38020565
|
2:38020560-38020582
|
| Sequence |
CCGGCGCTTGCGGGCCAGCTGGA |
GCTGGAGTTCCGGGTGGGCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 7, 2: 9, 3: 26, 4: 121} |
{0: 451, 1: 393, 2: 420, 3: 442, 4: 606} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|