|
Left Crispr |
Right Crispr |
| Crispr ID |
929520592 |
929520599 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:42647038-42647060
|
2:42647065-42647087
|
| Sequence |
CCCAGCTACTCGGGAGGCTGAGG |
AGAATGGCGTGGAACCCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576} |
{0: 1, 1: 13, 2: 388, 3: 563, 4: 988} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|