ID: 929550259_929550260

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 929550259 929550260
Species Human (GRCh38) Human (GRCh38)
Location 2:42886001-42886023 2:42886028-42886050
Sequence CCTGACATAATCTTCAGATAATT TCCTTTTGAGAGACAACTCTTGG
Strand - +
Off-target summary No data {0: 17, 1: 200, 2: 191, 3: 170, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!