ID: 929762087_929762097

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 929762087 929762097
Species Human (GRCh38) Human (GRCh38)
Location 2:44815103-44815125 2:44815127-44815149
Sequence CCACAGCCCTTGCCCCATTAGGA GGGCCTCCTGGTAGACACACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!