|
Left Crispr |
Right Crispr |
| Crispr ID |
929974609 |
929974615 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:46620273-46620295
|
2:46620320-46620342
|
| Sequence |
CCCTGTCCTACAAAGGACAGAAA |
GCCTGTAGTCCCAGCTACTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 32, 3: 89, 4: 602} |
{0: 71612, 1: 190254, 2: 237127, 3: 179987, 4: 110598} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|