|
Left Crispr |
Right Crispr |
| Crispr ID |
930115714 |
930115717 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:47716674-47716696
|
2:47716700-47716722
|
| Sequence |
CCTCTTGTGGAGGGCCTGACATC |
CAGGCCCACCCGCAGTTATCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 115, 1: 129, 2: 63, 3: 41, 4: 120} |
{0: 13, 1: 35, 2: 63, 3: 139, 4: 184} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|