ID: 930177383_930177400

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 930177383 930177400
Species Human (GRCh38) Human (GRCh38)
Location 2:48314780-48314802 2:48314823-48314845
Sequence CCCGGCCGGTCCCTCGCCTCCCG CGGGCGGAGCGGTCCCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 295} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!