ID: 930177384_930177396

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 930177384 930177396
Species Human (GRCh38) Human (GRCh38)
Location 2:48314781-48314803 2:48314807-48314829
Sequence CCGGCCGGTCCCTCGCCTCCCGG AGCTGACGGTGAGTCCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 286} {0: 1, 1: 0, 2: 0, 3: 4, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!