ID: 930177386_930177402

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 930177386 930177402
Species Human (GRCh38) Human (GRCh38)
Location 2:48314785-48314807 2:48314828-48314850
Sequence CCGGTCCCTCGCCTCCCGGCCGA GGAGCGGTCCCCTCCAGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 150} {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!