ID: 930177388_930177397

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 930177388 930177397
Species Human (GRCh38) Human (GRCh38)
Location 2:48314791-48314813 2:48314812-48314834
Sequence CCTCGCCTCCCGGCCGAGCTGAC ACGGTGAGTCCCGGGCGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 161} {0: 1, 1: 0, 2: 2, 3: 6, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!