ID: 930177398_930177407

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 930177398 930177407
Species Human (GRCh38) Human (GRCh38)
Location 2:48314821-48314843 2:48314850-48314872
Sequence CCCGGGCGGAGCGGTCCCCTCCA GCGCTCCCCGCCCCAGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 124} {0: 1, 1: 1, 2: 6, 3: 59, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!