ID: 930295400_930295406

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 930295400 930295406
Species Human (GRCh38) Human (GRCh38)
Location 2:49547492-49547514 2:49547536-49547558
Sequence CCATCAAAGCCCAGTAACCGGCC GAGTAGTTACCTGCAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 163, 3: 156, 4: 158} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!