ID: 930944829_930944842

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 930944829 930944842
Species Human (GRCh38) Human (GRCh38)
Location 2:57061297-57061319 2:57061339-57061361
Sequence CCCTCCCCTTTCCACAGGCACAG CCAGCACCACCAGTCCATGGTGG
Strand - +
Off-target summary {0: 2, 1: 56, 2: 188, 3: 393, 4: 778} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!