ID: 931261602_931261611

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 931261602 931261611
Species Human (GRCh38) Human (GRCh38)
Location 2:60624713-60624735 2:60624756-60624778
Sequence CCAGAGCCCATGGTGGGTGTGGG TTCACGTGTGAATCTTTGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 33, 4: 612}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!