ID: 931614578_931614586

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 931614578 931614586
Species Human (GRCh38) Human (GRCh38)
Location 2:64143796-64143818 2:64143829-64143851
Sequence CCAGCCAGGCGCGGGGCTCGGAG CGCGCCCCGCTCCCGGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 223} {0: 1, 1: 0, 2: 1, 3: 43, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!