ID: 931614582_931614598

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 931614582 931614598
Species Human (GRCh38) Human (GRCh38)
Location 2:64143823-64143845 2:64143849-64143871
Sequence CCGCCGCGCGCCCCGCTCCCGGG AGGGGGAGGCCGCGTAGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 669} {0: 1, 1: 0, 2: 0, 3: 20, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!