ID: 931695780_931695793

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 931695780 931695793
Species Human (GRCh38) Human (GRCh38)
Location 2:64869553-64869575 2:64869593-64869615
Sequence CCCCCAAGACCAAATCAGAAGGA GAAGGCAAGTGGGTGAATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 442} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!