ID: 931920492_931920504

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 931920492 931920504
Species Human (GRCh38) Human (GRCh38)
Location 2:67009890-67009912 2:67009933-67009955
Sequence CCCATGAGCTAATCACCTCCCTC AGGTCCCTCCCTTGACCGTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 39, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!