ID: 931965430_931965437

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 931965430 931965437
Species Human (GRCh38) Human (GRCh38)
Location 2:67528645-67528667 2:67528697-67528719
Sequence CCTAGAAAGTTCTAAGTAACCTT AATTTGCATATAATTGGAAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 41, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!