|
Left Crispr |
Right Crispr |
| Crispr ID |
932427952 |
932427959 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:71654975-71654997
|
2:71654996-71655018
|
| Sequence |
CCCAGCTACAGGAGGCTAAGGTG |
TGGGGGGATCATTTGAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 19, 2: 33, 3: 148, 4: 456} |
{0: 8, 1: 756, 2: 11775, 3: 39179, 4: 89752} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|