|
Left Crispr |
Right Crispr |
| Crispr ID |
932427952 |
932427960 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:71654975-71654997
|
2:71655005-71655027
|
| Sequence |
CCCAGCTACAGGAGGCTAAGGTG |
CATTTGAGCCCAGGAGTTCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 19, 2: 33, 3: 148, 4: 456} |
{0: 140, 1: 2115, 2: 7591, 3: 18002, 4: 32039} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|