ID: 932658759_932658763

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 932658759 932658763
Species Human (GRCh38) Human (GRCh38)
Location 2:73633891-73633913 2:73633913-73633935
Sequence CCTGGTTCAAGTGATTCTCCTGC CCTCAGTCTCCCGAGTAGCTGGG
Strand - +
Off-target summary {0: 33779, 1: 81745, 2: 101616, 3: 124160, 4: 74442} {0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!