|
Left Crispr |
Right Crispr |
| Crispr ID |
932658759 |
932658763 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:73633891-73633913
|
2:73633913-73633935
|
| Sequence |
CCTGGTTCAAGTGATTCTCCTGC |
CCTCAGTCTCCCGAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 33779, 1: 81745, 2: 101616, 3: 124160, 4: 74442} |
{0: 3228, 1: 113305, 2: 296144, 3: 221452, 4: 120028} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|