ID: 932780450_932780464

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 932780450 932780464
Species Human (GRCh38) Human (GRCh38)
Location 2:74555660-74555682 2:74555701-74555723
Sequence CCTGGGAAGGTAGACGCCTCAGA GTGAAGAGGAGGAGGGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 129} {0: 1, 1: 0, 2: 0, 3: 39, 4: 516}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!