ID: 932865351_932865356

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 932865351 932865356
Species Human (GRCh38) Human (GRCh38)
Location 2:75335675-75335697 2:75335724-75335746
Sequence CCATTGTCCATTTGTATATTCAG TAATTAAAAACAATGTAATGAGG
Strand - +
Off-target summary {0: 13, 1: 48, 2: 64, 3: 98, 4: 529} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!