ID: 933056993_933056998

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 933056993 933056998
Species Human (GRCh38) Human (GRCh38)
Location 2:77683108-77683130 2:77683133-77683155
Sequence CCAGGGACCAGCTTTGTGGAAGA ATTTTTCCACAGATGGGGCACGG
Strand - +
Off-target summary {0: 11, 1: 228, 2: 497, 3: 1115, 4: 1363} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!