|
Left Crispr |
Right Crispr |
Crispr ID |
933265683 |
933265687 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:80178372-80178394
|
2:80178412-80178434
|
Sequence |
CCCAGTAACAGGCCAAGAGCTGT |
AGTTATCTGCAGAAGATGACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 174, 1: 194, 2: 145, 3: 123, 4: 215} |
{0: 21, 1: 199, 2: 184, 3: 120, 4: 249} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|