ID: 933655194_933655204

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 933655194 933655204
Species Human (GRCh38) Human (GRCh38)
Location 2:84881101-84881123 2:84881119-84881141
Sequence CCCGCCCTGGCTAGCCGGGGCCG GGCCGCGGGGCGCCTCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 200} {0: 1, 1: 0, 2: 2, 3: 33, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!