ID: 933655194_933655205

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 933655194 933655205
Species Human (GRCh38) Human (GRCh38)
Location 2:84881101-84881123 2:84881120-84881142
Sequence CCCGCCCTGGCTAGCCGGGGCCG GCCGCGGGGCGCCTCCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 200} {0: 1, 1: 0, 2: 3, 3: 31, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!