ID: 933655195_933655215

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 933655195 933655215
Species Human (GRCh38) Human (GRCh38)
Location 2:84881102-84881124 2:84881153-84881175
Sequence CCGCCCTGGCTAGCCGGGGCCGC GCCCGGCAGCAGCGGCCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162} {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!