ID: 934305777_934305789

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 934305777 934305789
Species Human (GRCh38) Human (GRCh38)
Location 2:91820874-91820896 2:91820921-91820943
Sequence CCCGCGGCCTGCACTGATGACCT TGACACAGGAAGGGAGGACTAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 12, 3: 60, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!